Experimental and Computational Biology[ by Prof. Dr. Röbbe Wünschiers - University of Applied Sciences - Mittweida/Germany ] [publications]


[ Books ] [ Book Chapters ] [ Research ] [ CLB ] [ Miscellaneous ] [ Talks ] [ Poster ]


Brain dumps ...







Publication Metrics

Check out my publication metrics: Google Scholar | Thomson Reuters



Books


Wünschiers (erscheint im Herbst 2019)
Generation Gen-Schere – Wie begegnen wir der gentechnologischen Revolution?
SpringerSpektrum Heidelberg, ISBN 978-3-662-59047-8
[accompanying website]
   
Wünschiers (2019)
Gentechnik – Gene lesen, schreiben und editieren
SpringerSpektrum Heidelberg, ISBN 978-3-658-25126-0
[SpringerSpektrum] [accompanying website]
   
Wünschiers (2016)
Wiley-Schnellkurs Bioinformatik Datenmassen richtig fassen
Wiley-VCH Weinheim, ISBN 978-3-527-53040-3
[Wiley] [accompanying website]
   
Wünschiers (2013)
Computational Biology: A Practical Introduction to BioData Processing & Analysis with Linux, MySQL, and R
Springer Publishing Group, ISBN 978-3-642-34748-1
[Springer] [SpringerLink] [accompanying website] [Author Interview]
   
Wünschiers (2004)
Computational Biology: Unix/Linux, Data Processing and Programming
Springer Publishing Group, ISBN 3-540-21142-X
[SpringerLink] [accompanying website]
   
Wünschiers (1999)
Eigenschaften, Regulation und Funktion einer Hydrogenase im Wasserstoffmetabolismus der einzelligen Grünalge Scenedesmus obliquus
Görich & Weiershäuser Verlag Marburg, ISBN 3-89703-286-4, Dissertation
[PDF]
   


Book Chapters


Wünschiers (2017) Über die Modernisierung des Menschen. In: Busse & Beer (Eds.) Modernes Leben -- Leben in der Moderne; pp. 123-145; ISBN: 978-3-658-13751-9; VS Verlag für Sozialwissenschaften, Wiesbaden
   
Wünschiers (2016) Making-of Synthetic Biology: The European CyanoFactory Research Consortium. In: Hagen, Engelhard & Toepfer (Eds.) Ambivalences of Creating Life -- Societal and Philosophical Dimensions of Synthetic Biology; pp. 55-72; ISBN: 978-3-319-21087-2; Springer-Verlag, Berlin, Heidelberg
   
Wünschiers (2012) Chapter 3.1: Carbohydrate Metabolism and Citrate Cycle. pp. 37-58
Wünschiers (2012) Chapter 3.2: Amino Acids and Derivatives. pp. 58-82
Wünschiers (2012) Chapter 3.4: Lipids and Glycolipids. pp. 93-106
Wünschiers (2012) Chapter 3.5: Steroids and Isoprenoids. pp. 107-123
Wünschiers (2012) Chapter 3.6: Nucleotides and Nucleosides. pp. 124-133
Wünschiers (2012) Chapter 4.2: Protein Biosynthesis in Eukarya.pp. 219-232
Wünschiers (2012) Chapter 4.4: Posttranslational Modification of Proteins. pp. 238-244
In: Michal & Schomburg (Eds); Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology; 2nd Edition; ISBN 978-0-470-14684-2; John Wiley & Sons
   
Fenner & Wünschiers (2011) Von den Gebeinen Lucys zum Genom des Neandertalers. In: Dreesmann, Graf & Witte (Eds.) Evolutionsbiologie – Moderne Themen für den Unterricht; pp. 405-459; ISBN: 978-3-8274-2785-4; Spektrum Akademischer Verlag, Heidelberg [accompanying website]
   
Wünschiers (2003) Photobiological Hydrogen Metabolism and Hydrogenases from Green Algae. pp. 353-382
Wünschiers & Lindblad (2003) Light-Dependent Hydrogen Metabolism and Generation by Cyanobacteria. pp. 295-328
In: Nalwa (Ed); Handbook of Photochemistry and Photobiology; Vol. 4;ISBN 1-58883-004-7; American Scientific Publishers; North Lewis Way; CA/USA
   
Wünschiers, Senger & Schulz (1998) Photohydrogen Production - Hydrogenases In The Green Alga Scenedesmus obliquus.
In: Photosynthesis: Mechanisms and Effects. Ed.: G. Garab; Kluwer Acad. Publ.; Dordrecht/The Netherlands; Vol. III; pp. 1951-1954
   
Schulz, Schnackenberg, Stangier, Wünschiers, Zinn & Senger (1998) Light dependent hydrogen production of the green alga Scenedesmus obliquus.
In: BioHydrogen. Ed.: O.R. Zarborsky; Plenum Press; New York; pp. 243-251
   
Wünschiers, Appel, Stangier, Phunpruch & Schulz (1996) Investigations to Apply Biologically Produced Photohydrogen as a Future Energy Source.
In: Biomass for Energy and the Environment. Ed.: P. Chartier, G.J. Ferrero, U.M. Henius, S. Hultberg, J. Sachau, M. Wiinblad; 1. Edition; Elsevier Science Ltd.; Oxford/New York/Tokyo; pp. 1668-1673
   


Research & Education


2019

Benchmarking the MinION: Evaluating long reads for microbial profiling
Leidenfrost R, Pöther D, Jäckel U & Wünschiers R (submitted)

A single σ54 transcription factor L420P mutation contributes to increased nitrogen tolerance of photofermentative hydrogen production in Rhodobacter sphaeroides strain 2.4.1
Wappler N & Wünschiers R (submitted)

Genomic Characterization of a Continuous Hydrogen Producing Substrain of Rhodobacter spheroids
Wappler N, Helbig K, Weber J & Wünschiers R (submitted)

CyanoFactory, a European consortium to develop technologies needed to advance cyanobacteria as chassis for production of chemicals and fuels
Lindblad P, Fuente D, Borbe F, Cicchi B, Conejero JA, Couto N, Celesnik H, Diano M, Dolinar M, Esposito S, Evans C, Ferreira E, Keller J, Khanna N, Kind G, Landels A, Lemus L, Noirel J, Ocklenburg S, Oliveira P, Pacheco C, Parker J, Pereira J, Pham K, Pinto F, Rexroth S, Rögner M, Schmitz H-J, Silva Benavides AM, Siurana M, Tamagnini P, Touloupakis E, Torzillo G, Urchueguia J, Wegelius A, Wiegand K, Wright W, Wutschel M & Wünschiers R (2019) Algal Research 41:101510 DOI

2018

SDS-PAGE fractionation to increase metaproteomic insight into taxonomic and functional composition of microbial communities for biogas plant samples
Wenzel L, Heyer R, Schallert K, Löser L, Wünschiers R, Reichl U & Benndorf D (2018) Eng. Life Sci. 18:498-509. DOI

Analyse Biologischer Systeme: Von Datenmassen zum Modell
Wünschiers R
GIT Laborfachzeitschrift 62(3):41-43 [GIT Labor-Fachzeitschrift] [PDF]

2016

Über die Modernisierung des Menschen
R. Wünschiers
In: Busse S & Beer K, Modernes Leben - Leben in der Moderne. pp. 123-145; ISBN: 978-3-658-13751-9; Springer VS-Verlag, Berlin, Heidelberg
[WEB]

Making-of Synthetic Biology:
 The European CyanoFactory Research Consortium
R. Wünschiers (2016)
In: Hagen K, Engelhard M & Toepfer G, Ambivalences of Creating Life. Societal and Philosophical Dimensions of Synthetic Biology. pp. 55-72; ISBN: 978-3-319-21087-2; Springer-Verlag, Berlin, Heidelberg
[WEB]

2015

Re-Sequencing Rhodobacter sphaeroides strain 2.4.1 to facilitate understanding of varying hydrogen evolution rates
N. Wappler, E. Zuchantke & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 262-267). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

Protein Interaction Network Analysis and Visualization of Synechocystis sp. PCC 6803
E. Zuchantke, G. Kind & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 257-261). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

CyanoFactory Knowledge Base -- A web-based tool for analysis and visualization of experimental data
G. Kind, E. Zuchantke & R. Wünschiers
In: M. Knaut, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 187-191). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

CyanoFactory Knowledge Base & Synthetic Biology: A Plea for Human Curated Bio-databases
G. Kind, E. Zuchantke & R. Wünschiers
In: O. Pastor, C. Sinoquet, A. Fred, H. Gamboa, & D. Elias, 6th International Conference on Bioinformatics Models, Methods and Algorithms (pp. 237–242). Lisboa/Portugal, ISBN 978-989-758-070-3

2014

Efficiency of RNA extraction from selected bacteria in the context of biogas production and metatranscriptomics
L. Stark, T. Giersch & R. Wünschiers
Anaerobe 29:85-90 [PDF]

2012

A Clustering Approach to Detect mRNA-Degradation Patterns from DNA-Microarray Gene-Expression Data
S. Motameny & R. Wünschiers
Biosystems & Information Technology 1:6-13 [PDF]

Nutrilyzer: A Tool for Deciphering Atomic Stoichiometry of Differentially Expressed Paralogous Proteins.
K. Lotz, F. Schreiber & R. Wünschiers
J. Integr. Bioinf. 9:196 [PDF]

Determination of the equilibration concentrations of substances during recirculation of process water in anaerobic digestion plants.
L. Stark, T. Keil, C. Herbes & R. Wünschiers
In: Honekamp & Schindler (Eds); 13. Nachwuchswissenschaftlerkonferenz mitteldeutscher Fachhochschulen; ISBN 978-3-86870-436-5; pp 293-298

Synthetische Biologie – Nichts Neues? Plädoyer für eine Auseinandersetzung im Unterricht
R. Wünschiers
Praxis der Naturwissenschaften 61:23-34

Bioinformatik und Synthetische Biologie - Oder: Wie modern soll moderner Biologieunterricht sein?
D. Dreesmann & R. Wünschiers
Praxis der Naturwissenschaften 61:4-5

MAVisto: A Tool for Biological Network Motif Analysis
H. Schwöbbermeyer & R. Wünschiers
Methods in Molecular Biology 804:263-280
Example Network Files: [GML] | [NET]

2011

Biotechnologie - Endlich eine Ingenieurwissenschaft?
R. Wünschiers
Hochschulblatt Mittweida 34:41-42 [PDF]

2010

The LAILAPS Search Engine: Relevance Ranking in Life Science Databases
M. Lange, K. Spies, J. Bargsten, G. Haberhauer, M. Klapperstück, M. Leps, C. Weinel, R. Wünschiers, M. Weissbach, J. Stein and Uwe Scholz
J. Integr. Bioinf. 7:110, [download]

2009

Mehrskalen-Stoffwechselmodelle von Getreiden: Ein integrativer systembiologischer Ansatz für die Biomasseforschung
R. Lemke, M. Hajirezaei, B.H. Junker, J. Müller, B. Usadel, R. Wünschiers and F. Schreiber
GenomXPress 4/09: 16-18 [download issue]

An algorithmic approach to analyse genetic networks and biological energy production: an introduction and contribution where OR meets biology
Ö. Uğur, S.W. Pickl , G.W. Weber & R. Wünschiers
Optimization 58: 1-22 [abstract]


∇ Click to UN|FOLD Older Publications ∇




CLB


Beiträge für die Zeitschrift Chemie in Labor und Biotechnik.


2013

Synthetische Biologie – Forscher wollen Lego
A Mergner, M Wilhelm, T Zoll & R Wünschiers
Chemie in Labor und Biotechnik, 2013, 64: 296-309 [PDF]

2008

Wasserstoff und PDAs: Ein Experiment mit Brennstoffzellen
R. Wünschiers
Chemie in Labor und Biotechnik, 2008, 59: 102-106 [PDF]

2006

Sind wir, was wir aßen?
R. Wünschiers
Chemie in Labor und Biotechnik, 2006, 57: 128-134 [PDF]


∇ Click to UN|FOLD Older Publications ∇




Miscellaneous


2003

Brennstoff für die Zukunft: Psion als mobiles Messinstrument
R. Wünschiers
Notebook, Organizer & Handy, 2003, Heft 5: 106 [journal]

1999

Firmenportrait: ALVITO Biotechnologie GmbH
R. Wünschiers & S. Borzner
Laborjournal, 1999, Heft 9: 46 [journal]

Firmenportrait: Trifolio-M GmbH
S. Borzner & R. Wünschiers
Laborjournal, 1999, Heft 3: 32 [journal]

1998

Das Internet
S. Borzner & R. Wünschiers
Lebendige Erde, 1998, Heft 6: 531-534 [journal]

Diese Viren sind anders - Marburger Virologen untersuchen polares Knospen von Masernviren
S. Borzner & R. Wünschiers
Laborjournal, 1998, Heft 9: 20 [journal]

1996

Blue Light Syndrome III
R. Wünschiers
ESP Newsletter, 1996, 87: 7-8 [article]



Talks


Erbschaft – besteht aus mehr als Erbgut und Materiellem
12. Gothaer Seniorenakademie
Gotha; 25th of Frebruary 2019

WYSIWYG could be TGGTACAGCATCTGGTACGGC – or better
2nd Workshop BioInformatics meets Machine Learning
Mittweida; 12th of December 2018

Sollen wir uns gesund mutieren? Über Gentechnik und Menschen
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 15th of November 2018

Kann man Lebewesen bauen?
Lerncamp
Grünheide; 13th of September 2018

Nonlinear Life from a biological point of view
Summer School "Nonlinear Life edition 2"
Riga; 15th of August 2018

Kann Leben fabriziert werden?
Abend der Naturwissenschaften, Julius-Motteler-Gymnasium
Crimmitschau, 07th of June 2018

Egoistische Gene, böse Technik, oder was?
4. Ringvorlesung - Studium Generale
Mittweida; 2nd of May 2018

Umwelt – Dritte Welt – Eine Welt
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 26th of November 2017

From Computational to Synthetic Biology
SynbioDay – Infotag der Synthetischen Biologie
Düsseldorf; 5th of October 2017

Gene, Genome, Genies
LernCamp des gymnasialen Netzwerks zur individuellen Förderung besonders begabter Schülerinnen und Schüler (GIFted)
Auerbach/Germany; 1st of September 2017

Nonlinear Life from an Biological Point of View
Summer School "Nonlinear Life"
Riga; 24th of August 2017

Wir müssen reden! Über Züchtung – beim Menschen!
Nacht der Wissenschaften, Hochschule Mittweida
Mittweida; 9th of June 2017

Woher kommt der Strom aus der Steckdose?
KinderUni, Hochschule Mittweida
Mittweida; 5th of May 2017

Kinderwunsch - Wunschkinder. Wie aus Liebe Reproduktion wird.
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 24th of November 2016

Neue Gene ohne Technik? Über Dinge, die wir tun und lassen können.
Bürgerakademie, Hochschule Mittweida
Mittweida; 5th of October 2016


∇ Click to UN|FOLD Older Talks ∇




Poster


2019

Identification of genetic variants associated with cryptorchidism in German Sheep Poodle.
Rebecca Prause, Robert Leidenfrost & Röbbe Wünschiers
20ste Nachwuchswissenschaftlerkonferenz NWK19, Merseburg/Germany; 18-19th of June 2019

Herkunftsbestimmung von Pollen zur Analyse des Sammelverhaltens von Honigbienen und Hummeln.
Lisa Prudnikow, Robert Leidenfrost & Röbbe Wünschiers
20ste Nachwuchswissenschaftlerkonferenz NWK19, Merseburg/Germany; 18-19th of June 2019

WeDesign - Eine neuartige Plattform für die Modellierung und Simulation von Mikroorganismen.
Gabriel Kind & Röbbe Wünschiers
20ste Nachwuchswissenschaftlerkonferenz NWK19, Merseburg/Germany; 18-19th of June 2019

Reading Plant ITS2-Sequences with Nanopores and Polymerases: First Insights to Pros and Cons.
R Leidenfrost, S Bänsch, L Prudnikow, C Westphal & R Wünschiers
15th Gatersleben Research Conference on Applied Bioinformatics in Crops
Leibniz Institute of Plant Genetics and Crop Plant Research, Gatersleben/Germany; 18-22nd of March 2019

2018

Establishing Low Input Nanopore Sequencing
R Leidenfrost & R Wünschiers
19. Nachwuchswissenschaftlerkonferenz
Hochschule Anhalt/Germany; 5-6th of June 2018

2017

Biologische Wasserstoffproduktion durch Fruchtsaftfermentation mit Rhodobacter sphaeroides Stamm 2.4.1
N Wappler & R Wünschiers
7. Statuskonferenz "Bioenergie - mehr als eine sichere Reserve?!" des Förderprogramms "Energetische Biomassenutzung"
Leipzig November 20-21, 2017

Entwicklung von Methoden für die genombasierte Analyse von Mikroorganismen in Bioaerosolen
R Leidenfrost & R Wünschiers
Expertenforum Bioaerosole - Von der Messung zur Bewertung
Berlin, Germany; September 26-27, 2017

Towards introducing nanopore sequencing to undergraduate ducation in biotechnology and computational biology
R Leidenfrost & R Wünschiers
18. Nachwuchswissenschaftlerkonferenz
Hochschule Mittweida/Germany; 31st of May 2017

2016

Description and application of a pipeline for generating versions of genome-scale metabolic models from sequence information
E Zuchantke, M Siurana, D Fuente, L Lemus, R Wünschiers & JF Urchueguía
XIII Symposium on Bioinformatics
Valencia/Spain, May 10th to 13th 2016

Untersuchung der Dynamik biochemischer Prozesse einer Biogasanlage während des Anfahrens - Eine Metatranskriptomstudie
Stark, Lucy; Wünschiers, Röbbe
17. Nachwuchswissenschaftlerkonferenz 2016
Hochschule Schmalkalden/Germany; 20th of April 2016

Cell-Free Protein Production – The Development Of An In Vitro Expression System For (Cyano)Bacteria
Leidenfrost, Robert; Wünschiers, Röbbe
17. Nachwuchswissenschaftlerkonferenz 2016
Hochschule Schmalkalden/Germany; 20th of April 2016


∇ Click to UN|FOLD Older Posters ∇



 
publications.txt · Last modified: 2019/08/16 14:54 by superadmin
Prof. Dr. Röbbe Wünschiers - University of Applied Sciences - Technikumplatz 17 - 09648 Mittweida/Germany - roebbe.wuenschiers|AT|hs-mittweida.de
Recent changes RSS feed Driven by DokuWiki