Experimental and Computational Biology[ by Prof. Dr. Röbbe Wünschiers - University of Applied Sciences - Mittweida/Germany ] [publications]


Brain dumps ...






Publication Metrics

Check out my publication metrics: Google Scholar | Thomson Reuters | Research Gate


Publications







ALL

👀 PEER REVIEWED

🧬 RESEARCH

💡EDUCATION

📚 BOOKS

📖 CHAPTERS

📄 PROCEEDINGS

⚗️ CLB

⛱ POPULAR

📈 POSTER

🎤 TALKS

🧬 A single σ54 transcription factor L420P mutation contributes to increased nitrogen tolerance of photofermentative hydrogen production in Rhodobacter sphaeroides strain 2.4.1.
Wappler N & Wünschiers R (in preparation)

🧬 Genomic Characterization of a Continuous Hydrogen Producing Substrain of Rhodobacter spheroids.
Wappler N, Helbig K, Weber J & Wünschiers R (in preparation)

🧬 Benchmarking of short-read and hybrid assembly strategies for comprehensive genomic analysis of Francisella tularensis.
Neubert K, Zuchantke E, Leidenfrost RM, Wünschiers R, Grützke J, Malorny B, Brendebach H, Al Dahouk S, Homeier-Bachmann T, Hotzel H, Reinert K, Tomaso H & Busch A (submitted) Genome Biology

🧬 WeDesign – An open-source, web-based software for metabolic modelling and flux-balance analyses.
Kind G, Siurana M, Fuente D, Zuchantke E, Lemus L, Urchueguía Schölzel J & Wünschiers R (submitted) BMC Bioinformatics


🧬 Using ITS2 metabarcoding and microscopy to analyze shifts in pollen diets of honey bees and bumble bees along a mass-flowering crop gradient.
Bänsch S, Tscharntke T, Wünschiers R, Netter L, Brenig B, Gabriel D & Westphal C (accepted) Mol Ecology


⚗️ DNA-Sequenzierung in der dritten Generation: Von den Anfängen der Sequenziertechnik bis zu Nanoporen.
Prudnikow LC & Wünschiers R (2020) Chemie in Labor und Biotechnik 71:324–335

🧬 Draft genome assembly of Rhodobacter sphaeroides 2.4.1 substrain H2 from nanopore data.
Leidenfrost RM, Wappler N & Wünschiers R (2020) Microbiol Resour Announc 9:e00414-20. doi: 10.1128/MRA.00414-20

🧬 Benchmarking the MinION: Evaluating long reads for microbial profiling.
Leidenfrost RM, Pöther D, Jäckel U & Wünschiers R (2020) Sci Rep 10:5125. doi: 10.1038/s41598-020-61989-x

🧬 Analyzing the dietary diary of bumble bee.
Leidenfrost RM, Bänsch S, Prudnikow L, Brenig B, Westphal C & Wünschiers R (2020) Front Plant Sci 11:287. doi: 10.3389/fpls.2020.00287

⚗️ Ein Lehrmeister war das Immunsystem – Genetische Information lesen und verändern.
Wünschiers R (2020) Chemie in Labor und Biotechnik 71:130–143

📚 Studienheft Genome und ihre Evolution.
Wünschiers R (2020) Springer, Heidelberg. doi: 10.1007/978-3-662-61291-0
📚 Studienheft Gentechnik 3.
Wünschiers R (2020) Springer, Heidelberg. doi: 10.1007/978-3-662-61297-2
📚 Studienheft Gentechnik 2.
Wünschiers R (2020) Springer, Heidelberg. doi: 10.1007/978-3-662-61295-8
📚 Studienheft Gentechnik 1.
Wünschiers R (2020) Springer, Heidelberg. doi: 10.1007/978-3-662-61293-4
📚 Studienheft Zellbiologie 5 – Zellkultur.
Wünschiers R (2020) Springer, Heidelberg. doi: 10.1007/978-3-662-61299-6

🧬 CyanoFactory, a European consortium to develop technologies needed to advance cyanobacteria as chassis for production of chemicals and fuels.
Lindblad P, Fuente D, Borbe F, Cicchi B, Conejero JA, Couto N, Celesnik H, Diano M, Dolinar M, Esposito S, Evans C, Ferreira E, Keller J, Khanna N, Kind G, Landels A, Lemus L, Noirel J, Ocklenburg S, Oliveira P, Pacheco C, Parker J, Pereira J, Pham K, Pinto F, Rexroth S, Rögner M, Schmitz H-J, Silva Benavides AM, Siurana M, Tamagnini P, Touloupakis E, Torzillo G, Urchueguia J, Wegelius A, Wiegand K, Wright W, Wutschel M & Wünschiers R (2019) Algal Research 41:101510. doi: j.algal.2019.101510

📚 Generation Gen-Schere – Wie begegnen wir der gentechnologischen Revolution?
Wünschiers R (2019) Springer-Spektrum, Heidelberg. doi: 10.1007/978-3-662-59048-5 [accompanying website]
📚 Gentechnik – Gene lesen, schreiben und editieren.
Wünschiers R (2019) Springer Spektrum, Heidelberg. doi: 10.1007/978-3-658-25127-7 [accompanying website]

🧬 SDS-PAGE fractionation to increase metaproteomic insight into taxonomic and functional composition of microbial communities for biogas plant samples.
Wenzel L, Heyer R, Schallert K, Löser L, Wünschiers R, Reichl U & Benndorf D (2018) Eng Life Sci 18:498–509. doi: 10.1002/elsc.201800062

💡 Analyse Biologischer Systeme: Von Datenmassen zum Modell.
Wünschiers R (2018) GIT Laborfachzeitschrift 62:41–3. ⬇️

📖 Über die Modernisierung des Menschen.
Wünschiers R (2017) In: Busse S & Beer K (Eds) Modernes Leben – Leben in der Moderne. Springer VS, Wiesbaden. doi: 10.1007/978-3-658-13752-6_9
📖 Making-of Synthetic Biology: The European CyanoFactory Research Consortium.
Wünschiers R (2016) In: Hagen K, Engelhard M & Toepfer G (Eds) Ambivalences of Creating Life – Societal and Philosophical Dimensions of Synthetic Biology. Springer Verlag, Heidelberg. doi: 10.1007/978-3-319-21088-9_3
📚 Wiley-Schnellkurs Bioinformatik – Datenmassen richtig fassen.
Wünschiers R (2016) Wiley-VCH, Weinheim. ISBN 978-3-527-53040-3 [accompanying website]

📄 Re-Sequencing Rhodobacter sphaeroides strain 2.4.1 to facilitate understanding of varying hydrogen evolution rates.
Wappler N, Zuchantke E & Wünschiers R (2015) In: Knaut M, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 262-267). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

📄 Protein Interaction Network Analysis and Visualization of Synechocystis sp. PCC 6803.
Zuchantke E, Kind G & Wünschiers R (2015) In: Knaut M, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 257-261). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

📄 CyanoFactory Knowledge Base & Synthetic Biology: A Plea for Human Curated Bio-databases.
Kind G, Zuchantke E & Wünschiers R (2015) In: Pastor O, Sinoquet C, Fred A, Gamboa H, & Elias D, 6th International Conference on Bioinformatics Models, Methods and Algorithms (pp. 237–242). Lisboa/Portugal, ISBN 978-989-758-070-3

📄 CyanoFactory Knowledge Base – A web-based tool for analysis and visualization of experimental data.
Kind G, Zuchantke E & Wünschiers R (2015) In: Knaut M, Tagungsband der 16. Nachwuchswissenschaftlerkonferenz (pp. 187-191). Berliner Wissenschaftsverlag, Berlin, ISBN 978-3-8305-2044-3

🧬 Efficiency of RNA extraction from selected bacteria in the context of biogas production and metatranscriptomics.
Stark L, Giersch T & Wünschiers R (2014) Anaerobe 29:85-90. doi: 10.1016/j.anaerobe.2013.09.007

⚗️ Synthetische Biologie – Forscher wollen Lego.
Mergner A, Wilhelm M, Zoll T & Wünschiers R (2013) Chemie in Labor und Biotechnik 64:296–309 ⬇️

📚 Computational Biology: A Practical Introduction to BioData Processing & Analysis with Linux, MySQL, and R.
Wünschiers R (2013) Springer Publishing Group, Heidelberg. doi: 10.1007/978-3-642-34749-8 [accompanying website] [Author Interview]

🧬 Nutrilyzer: A Tool for Deciphering Atomic Stoichiometry of Differentially Expressed Paralogous Proteins.
Lotz K, Schreiber F & Wünschiers R (2012) J Integr Bioinf 9:196. doi: 10.2390/biecoll-jib-2012-196

🧬 MAVisto: A Tool for Biological Network Motif Analysis.
Schwöbbermeyer H & Wünschiers R (2012) Methods in Molecular Biology 804:263-280. Example Network Files: GML | doi: 10.1007/978-1-61779-361-5_14

🧬 A Clustering Approach to Detect mRNA-Degradation Patterns from DNA-Microarray Gene-Expression Data.
Motameny S & Wünschiers R (2012) Biosys & Inf Technol 1:6-13. doi: 10.11592/bit.121001

📄 Determination of the equilibration concentrations of substances during recirculation of process water in anaerobic digestion plants.
Stark L, Keil T, Herbes C & Wünschiers R (2012) In: Honekamp & Schindler (Eds); 13. Nachwuchswissenschaftlerkonferenz mitteldeutscher Fachhochschulen; ISBN 978-3-86870-436-5; pp 293-298

💡 Synthetische Biologie – Nichts Neues? Plädoyer für eine Auseinandersetzung im Unterricht.
Wünschiers R (2012) Praxis der Naturwissenschaften 61:23-34

💡 Bioinformatik und Synthetische Biologie - Oder: Wie modern soll moderner Biologieunterricht sein?
Dreesmann D & Wünschiers R (2012) Praxis der Naturwissenschaften 61:4-5

📖 Chapter 3.1: Carbohydrate Metabolism and Citrate Cycle. pp 37-58
📖 Chapter 3.2: Amino Acids and Derivatives. pp 58-82
📖 Chapter 3.4: Lipids and Glycolipids. pp 93-106
📖 Chapter 3.5: Steroids and Isoprenoids. pp 107-123
📖 Chapter 3.6: Nucleotides and Nucleosides. pp 124-133
📖 Chapter 4.2: Protein Biosynthesis in Eukarya. pp 219-232
📖 Chapter 4.4: Posttranslational Modification of Proteins. pp 238-244
Wünschiers R (2012) In: Michal G & Schomburg D (Eds) Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology. 2nd edition, John Wiley & Sons. doi: 10.1002/9781118657072

💡 Biotechnologie - Endlich eine Ingenieurwissenschaft?
Wünschiers R (2011) Hochschulblatt Mittweida 34:41-42 ⬇️

📖 Von den Gebeinen Lucys zum Genom des Neandertalers.
Fenner A & Wünschiers R (2011) In: Dreesmann, Graf & Witte (Eds) Evolutionsbiologie – Moderne Themen für den Unterricht. pp. 405-459; Spektrum Akademischer Verlag, Heidelberg. doi: 10.1007/978-3-8274-2786-1_15 [accompanying website]

🧬 The LAILAPS Search Engine: Relevance Ranking in Life Science Databases.
Lange M, Spies K, Bargsten J, Haberhauer G, Klapperstück M, Leps M, Weinel C, WünschiersR, Weissbach M, Stein J & Scholz U (2010) J Integr Bioinf 7:110. doi: 10.2390/biecoll-jib-2010-110

🧬 An algorithmic approach to analyse genetic networks and biological energy production: an introduction and contribution where OR meets biology.
Uğur Ö, Pickl SW, Weber GW & Wünschiers R (2009) Optimization 58:1-22. doi: 10.1080/02331930701761169

💡 Mehrskalen-Stoffwechselmodelle von Getreiden: Ein integrativer systembiologischer Ansatz für die Biomasseforschung.
Lemke R, Hajirezaei M, Junker BH, Müller J, Usadel B, Wünschiers R & Schreiber F (2009) GenomXPress 4/09:16-18.

💡 Evolution der Pathogenität bei E. coli - Wie Bioinformatik hilft, Pathogenitätsfaktoren zu identifizieren.
Wünschiers R (2008) Praxis der Naturwissenschaft 57(4):29–33

⚗️ Wasserstoff und PDAs: Ein Experiment mit Brennstoffzellen.
Wünschiers R (2008) Chemie in Labor und Biotechnik 59:102–106. ⬇️

🧬 OrfMapper: A Web-Based Application for Visualizing Gene Clusters on Metabolic Pathway Maps.
Wünschiers R & Vellguth M (2007) ArXiv for Genomics: 0706.3477

🧬 Experimental and bioinformatic approaches for analyzing and visualizing cyanobacterial nitrogen and hydrogen metabolism.
Wünschiers R, Axelsson R, Vellguth M & Lindblad P (2007) Elec J Biotech 10:4. doi: 10.2225/vol10-issue4-fulltext-2

🧬 An Algorithm to Analyze Stability of Gene-Expression Patterns.
Gebert J, Lätsch M, Pickl SW, Weber GW & Wünschiers R (2006) Discrete Appl Math 154:1140–1156. doi: 10.1016/j.dam.2004.08.011

🧬 Effects of Growth on Dinitrogen on the Transcriptome and Predicted Proteome of Nostoc PCC 7120.
Wünschiers R, Axelsson R & Lindblad P (2006) ArXiv for Genomics: q-bio/0604031

🧬 Nitrogen availability for nitrogen fixing cyanobacteria upon growth on dinitrogen.
Wünschiers R (2006) Afr J Biotech 5:1969–1972. doi: 10.5897/AJB2006.000-5097

💡 Computational biology – gaining command of the data stream.
Wünschiers R (2006) Biologist 53:195–198

⚗️ Sind wir, was wir aßen?
Wünschiers R (2006) Chemie in Labor und Biotechnik 57:128–134. ⬇️

📄 Gene expression regulation at the transcriptome level.
Wünschiers R & Heuser S (2005) Proc HIBIT, Ankara/Turkey

💡 Computational Biology – Eine Einführung.
Wünschiers R (2005) Biologie in Unserer Zeit 35:90–99. doi: 10.1002/biuz.200410275

⚗️ Linux et al. – Teil 15: Awk - Mathematische und textbezogene Befehle.
Wünschiers R (2005) Chemie in Labor und Biotechnik 56:22-26. ⬇️

📄 Genetic Networks and Anticipation of Gene-Expression Patterns.
Gebert J, Lätsch M, Radde N, Pickl SW, Weber GW & Wünschiers R (2004) AIP Conf Proc 718:474–485. doi: 10.1063/1.1787351

⚗️ Die Mikroarray-Maschine der febit AG.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:8-13. ⬇️

⚗️ Linux et al. – Teil 14: Awk - Kontrollstrukturen.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:461-464. ⬇️

⚗️ Linux et al. – Teil 13: Awk - Daten Eingabe, Ausgabe und Formatierung.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:421-424. ⬇️

⚗️ Linux et al. – Teil 12: Awk - Skalare, Arrays, Hashes.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:382-386. ⬇️

⚗️ Linux et al. – Teil 11: Awk - Trennzeichen & Muster.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:347-350. ⬇️

⚗️ Linux et al. – Teil 10: Awk - Grundlagen.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:302-304. ⬇️

⚗️ Linux et al. – Teil 9: Datenprozessierung mit Skriptsprachen.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:261-264. ⬇️

⚗️ Linux et al. – Teil 8: Computational Chemistry.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:223-227. ⬇️

⚗️ Linux et al. – Teil 7: Die graphische Oberfläche: X-Windows.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:181-183. ⬇️

⚗️ Linux et al. – Teil 6: Textsuche mit Schuss: Reguläre Ausdrücke.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:141-144. ⬇️

⚗️ Linux et al. – Teil 5: Kleine Helferlein.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:109-110. ⬇️

⚗️ Linux et al. – Teil 4: Textverarbeitung.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:61-63. ⬇️

⚗️ Linux et al. – Teil 3: Hilfe & Jonglieren mit Dateien.
Wünschiers R (2004) Chemie in Labor und Biotechnik 55:25-27. ⬇️

📚 Computational Biology: Unix/Linux, Data Processing and Programming.
Wünschiers R (2004) Springer Publishing Group, Heidelberg. doi: 10.1007/978-3-642-18552-6 [accompanying website]

📄 Towards DNA-Chip Analysis and Discrete Tomography by Inverse Problems and Optimization.
Gebert J, Pickl SW, Shokina N, Weber GW & Wünschiers R (2003) Proceedings of the 4th MATHMOD, Vienna. Eds: I Troch & F Breitenecker. ISBN 3-901608-24-9, pp. 1298–1302

🧬 Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria.
Wünschiers R, Batur M & Lindblad P (2003) BMC Microbiology 3:8. doi: 10.1186/1471-2180-3-8

🧬 Mathematical Modeling and Discrete Approximation in Evaluation and Forecasting of Gene-Expression Data.
Gebert J, Lätsch M, Pickl SW, Weber GW & Wünschiers R (2003) Electr Notes in Discrete Math 13:1–5. doi: 10.1016/S1571-0653(04)00437-8

Brennstoff für die Zukunft: Psion als mobiles Messinstrument.
Wünschiers R (2003) Notebook, Organizer & Handy: Heft 5:106

⚗️ G(e)nomforschung Teil 2 – Über Information und das kleinste Genom.
Wünschiers R (2003) Chemie in Labor und Biotechnik 54:48-53. ⬇️

⚗️ G(e)nomforschung Teil 1 – Über Information und das kleinste Genom.
Wünschiers R (2003) Chemie in Labor und Biotechnik 54:8-13. ⬇️

⚗️ Linux et al. – Teil 2: Shells & Files & Folders.
Wünschiers R (2003) Chemie in Labor und Biotechnik 54:460-463. ⬇️

⚗️ Linux et al. – Teil 1: Betriebssysteme der anderen Art.
Wünschiers R (2003) Chemie in Labor und Biotechnik 54:420-423. ⬇️

📖 Photobiological Hydrogen Metabolism and Hydrogenases from Green Algae. Wünschiers (2003) pp. 353-382
📖 Light-Dependent Hydrogen Metabolism and Generation by Cyanobacteria. Wünschiers & Lindblad (2003) pp. 295-32
In: Nalwa HS (Ed) Handbook of Photochemistry and Photobiology – Vol 4. American Scientific Publishers, North Lewis Way, CA/USA. ISBN 978-1-58883-004-3

📄 Algorithmic analysis of gene expression data with polyhedral structures.
Gebert J, Pickl SW, Shokina N, Weber GW & Wünschiers R (2002) In: Similarity Methods (5th International Workshop), Eds: Kröplin B, Rudolph S & Häcker J. ISBN 3-930683-47-4, pp. 79–87

🧬 Hydrogenases and Hydrogen Metabolism of Cyanobacteria.
Tamagnini P, Axelsson R, Lindberg P, Oxelfelt F, Wünschiers R & Lindblad P (2002) Microbiol Mol Biol Rev 66:1–20. doi: 10.1128/MMBR.66.1.1-20.2002

💡 Biologische Wasserstoffgewinnung mit Grünalgen.
Mahlke A & Wünschiers R (2002) Unterricht Biologie 273:43–48

💡 Hydrogen in Education - A Biological Approach.
Wünschiers R & Lindblad P (2002) Int J Hydrogen Energy 27:1131–1140. doi: 10.1016/S0360-3199(02)00098-8

⚗️ Der Niembaum in Pflanzenschutz und Medizin.
Wünschiers R (2002) Chemie in Labor und Biotechnik 53:55-58. ⬇️

🧬 Molecular evidence for Fe-hydrogenase in the green alga Scenedesmus obliquus.
Wünschiers R, Stangier K, Senger H & R. Schulz R (2001) Curr Microbiol 42:353–360. doi: 10.1007/s002840010229

🧬 Electron pathways involved in H2-metabolism in the green alga Scenedesmus obliquus.
Wünschiers R, Senger H & Schulz R (2001) Biochim Biopyhs Acta 1503:271–278. doi: 10.1016/S0005-2728(00)00204-8

🧬 Cloning and characterization of a hyp gene cluster in the filamentous cyanobacterium Nostoc sp. strain PCC 73102.
Hansel A, Axelsson R, Lindberg P, Troshina O, Wünschiers R & Lindblad P (2001) FEMS Microbiol Lett 201:59–64. doi: 10.1016/S0378-1097(01)00240-3

⚗️ Herstellung und Anwendung von DNA-Mikroarrays.
Wünschiers R, Zinn T & Borzner S (2001) Chemie in Labor und Biotechnik 52:260-266. ⬇️

⚗️ Gentechnik im Pflanzenschutz: Ist die Chemie am Ende?
Wünschiers R (2001) Chemie in Labor und Biotechnik 52:48-56. ⬇️

⚗️ Die Biochemie des Gedächtnisses.
Wünschiers R (2001) Chemie in Labor und Biotechnik 52:324-331. ⬇️

⚗️ Biologische "Elektrolyse" durch Mikroalgen.
Wünschiers R (2001) Chemie in Labor und Biotechnik 52:168-174. ⬇️

💡 Light dependent production of hydrogen gas by green algae. The future energy carrier in the classroom?
Wünschiers R (2000) J Biol Edu 34:214–217. doi: 10.1080/00219266.2000.9655721

⚗️ Molekularbiologie: Ein historischer Rückblick.
Wünschiers R, Wünschiers C & Borzner S (2000) Chemie in Labor und Biotechnik 51:138-143

⚗️ Metalle in der Biologie.
Wünschiers R & Borzner S(2000) Chemie in Labor und Biotechnik 51:210-216

⚗️ Die Polymerase Kettenreaktion und ihre Anwendung.
Zinn T, Wünschiers R & Borzner S (2000) Chemie in Labor und Biotechnik 51:449-455

⚗️ Apoptose: Wenn Zellen sterben.
Wünschiers R & Borzner S (2000) Chemie in Labor und Biotechnik 51:328-3333

Firmenportrait: Trifolio-M GmbH.
Borzner S & Wünschiers R (1999) Laborjournal: Heft 3:32

Firmenportrait: ALVITO Biotechnologie GmbH.
Wünschiers R & Borzner S (1999) Laborjournal: Heft 9:46

🧬 Redox control of hydrogenase activity in the green alga Scenedesmus obliquus by thioredoxin and other thiols.
Wünschiers R, Heide H, Follmann H, Senger H & Schulz R (1999) FEBS Lett 455:162–164. doi: 10.1016/s0014-5793(99)00867-4

⚗️ Wie Tiere und Pflanzen die Uhr ablesen.
Wünschiers R & Borzner S (1999) Chemie in Labor und Biotechnik 50:60-64

⚗️ Wasserstoff als Energieträger.
Wünschiers R & Borzner S (1999) Chemie in Labor und Biotechnik 50:141-146

⚗️ Optische Mikrosensoren zur Sauerstoffmessung.
Wünschiers R, Borzner S & Stangelmayer A (1999) Chemie in Labor und Biotechnik 50:209-214

⚗️ Cyanidresistente Atmung bei Pflanzen.
Finke C, Wünschiers R & Borzner S (1999) Chemie in Labor und Biotechnik 50:340-344

📚 Eigenschaften, Regulation und Funktion einer Hydrogenase im Wasserstoffmetabolismus der einzelligen Grünalge Scenedesmus obliquus.
Wünschiers (1999) Görich & Weiershäuser Verlag Marburg, ISBN 3-89703-286-4, Dissertation. ⬇️

Diese Viren sind anders – Marburger Virologen untersuchen polares Knospen von Masernviren.
Borzner S & Wünschiers R (1998) Laborjournal: Heft 9:20

Das Internet.
Borzner S & Wünschiers R (1998) Lebendige Erde: Heft 6:531-534

📄 Biotechnological approach for future use of solar energy: Photohydrogen production by the green alga Scenedesmus obliquus and the cyanobacterium Synechocystis sp. PCC 6803.
Schulz R, Appel J, Phunpruch S, Stangier K & Wünschiers R (1998) In: Proceedings of the 12th World Hydrogen Energy Conference 1998. Ed.: JC Bolcich und TN Veziroglu. 1st Edition. Argentinien, pp. 2069–2078

💡 Photosynthese und Wasserstoff: Grundlagen und Nutzung Wünschiers R & Schulz R (1998) Biologie in Unserer Zeit 28:130–136. doi 10.1002/biuz.960280303

⚗️ Die Tetrapyrrol-Biosynthese.
Wünschiers R & Borzner S (1998) Chemie in Labor und Biotechnik 49:464-469

⚗️ Die Phyllosphäre.
Wünschiers R & Borzner S (1998) Chemie in Labor und Biotechnik 49:293-296

⚗️ Die Photosynthese im Reagenzglas.
Wünschiers R & Borzner S (1998) Chemie in Labor und Biotechnik 49:140-145

📖 Photohydrogen Production – Hydrogenases In The Green Alga Scenedesmus obliquus.
Wünschiers R, Senger H & Schulz R (1998) In: Garab G (Ed) Photosynthesis: Mechanisms and Effects – Vol 3. Kluwer Acad Publ, Dordrecht/NL. doi: 10.1007/978-94-011-3953-3_455
📖 Light dependent hydrogen production of the green alga Scenedesmus obliquus.
Schulz R, Schnackenberg J, Stangier K, Wünschiers R, Zinn T & Senger H (1998) In: Zarborsky OR (Ed) BioHydrogen. Plenum Press, New York. doi: 10.1007/978-0-585-35132-2_32

🧬 Purification and characterization of cytochrome c6 from the unicellular green alga Scenedesmus obliquus.
Wünschiers R, Zinn T, Linder D & Schulz R (1997) Z Naturforsch [C] 52:740–746. doi: 10.1515/znc-1997-11-1204

⚗️ Sekundäre Pflanzeninhaltsstoffe und ihre Bedeutung für Pflanze und Mensch.
Wünschiers R & Borzner S (1997) Chemie in Labor und Biotechnik 48:466-471

⚗️ Pflanzliche Reaktionen auf Stress.
Wünschiers R & Borzner S (1997) Chemie in Labor und Biotechnik 48:234-238

⚗️ Extreme Anpassungen von Pflanzen.
Wünschiers R & Borzner S (1997) Chemie in Labor und Biotechnik 48:138–144

Blue Light Syndrome III.
Wünschiers R (1996) ESP Newsletter 87:7–8

📖 Investigations to Apply Biologically Produced Photohydrogen as a Future Energy Source.
Wünschiers R, Appel J, Stangier K, Phunpruch S & Schulz R (1996) In: Chartier P, Ferrero GJ, Henius UM, Hultberg S, Sachau J, Wiinblad M (Eds) Biomass for Energy and the Environment. Elsevier Science Ltd.; Oxford/UK. doi: 10.1016/B978-0-08-042849-9.50038-0

🎤 Erbschaft – besteht aus mehr als Erbgut und Materiellem
12. Gothaer Seniorenakademie
Gotha; 25th of Frebruary 2019

🎤 WYSIWYG could be TGGTACAGCATCTGGTACGGC – or better
2nd Workshop BioInformatics meets Machine Learning
Mittweida; 12th of December 2018

🎤 Sollen wir uns gesund mutieren? Über Gentechnik und Menschen
Tag der Wissenschaften, Berufliches Schulzentrum für Gastgewerbe
Dresden; 15th of November 2018

🎤 Kann man Lebewesen bauen?
Lerncamp
Grünheide; 13th of September 2018

🎤 Nonlinear Life from a biological point of view
Summer School "Nonlinear Life edition 2"
Riga; 15th of August 2018

🎤 Kann Leben fabriziert werden?
Abend der Naturwissenschaften, Julius-Motteler-Gymnasium
Crimmitschau, 07th of June 2018

🎤 Egoistische Gene, böse Technik, oder was?
4. Ringvorlesung - Studium Generale
Mittweida; 2nd of May 2018


∇ Click to UN|FOLD Older Talks ∇


📈 Identification of genetic variants associated with cryptorchidism in German Sheep Poodle.
Prause R, Leidenfrost RM & Wünschiers R
20ste Nachwuchswissenschaftlerkonferenz NWK19
Merseburg/Germany; 18-19th of June 2019

📈 Herkunftsbestimmung von Pollen zur Analyse des Sammelverhaltens von Honigbienen und Hummeln.
Prudnikow L, Leidenfrost RM & Wünschiers R
20ste Nachwuchswissenschaftlerkonferenz NWK19
Merseburg/Germany; 18-19th of June 2019

📈 WeDesign - Eine neuartige Plattform für die Modellierung und Simulation von Mikroorganismen.
Kind G & Wünschiers R
20ste Nachwuchswissenschaftlerkonferenz NWK19
Merseburg/Germany; 18-19th of June 2019

📈 Reading Plant ITS2-Sequences with Nanopores and Polymerases: First Insights to Pros and Cons.
Leidenfrost RM, Bänsch S, Prudnikow L, Westphal C & Wünschiers R
15th Gatersleben Research Conference on Applied Bioinformatics in Crops
Leibniz Institute of Plant Genetics and Crop Plant Research, Gatersleben/Germany; 18-22nd of March 2019


∇ Click to UN|FOLD Older Posters ∇


 
publications.txt · Last modified: 2020/09/21 10:29 by superadmin
Prof. Dr. Röbbe Wünschiers - University of Applied Sciences - Technikumplatz 17 - 09648 Mittweida/Germany - roebbe.wuenschiers|AT|hs-mittweida.de
Recent changes RSS feed Driven by DokuWiki